Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3526789
End position: 3526833
Length: 45

DNA sequence
>NC_015726, from 3526789 to 3526833 (45 bp); Cupriavidus necator N-1 GGGTCGATCGGATTCCGGTCGCTCGGAGTCGGATCGATCGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3526208-3527059	Sequence	CNE_1c33760 aroK2 shikimate kinase AroK (Protein is coded in complementary strand; from 3527059 to 3526208)