Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3262336
End position: 3262380
Length: 45

DNA sequence
>NC_015726, from 3262336 to 3262380 (45 bp); Cupriavidus necator N-1 ACCGCGGCCTTCTTGGCCGGGGCCTTCTTGGCGGCTGCCTTCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3261967-3262551	Sequence	CNE_1c31340 - histone H1-like protein (Protein is coded in complementary strand; from 3262551 to 3261967)