Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2691996
End position: 2692040
Length: 45

DNA sequence
>NC_015726, from 2691996 to 2692040 (45 bp); Cupriavidus necator N-1 CGCGGGCGTGTCGGCGGCGGGCGTGTCGGCGGCCGGCGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2691991-2692632	Sequence	CNE_1c26070 orn oligoribonuclease Orn (Protein is coded in complementary strand; from 2692632 to 2691991)