Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 377462
End position: 377497
Length: 36

DNA sequence
>NC_015726, from 377462 to 377497 (36 bp); Cupriavidus necator N-1 CCACGCCAGGCACCGCGCCAGGCACCACGCCAGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 377367-378071	Sequence	CNE_1c03830 rsmD ribosomal RNA small subunit methyltransferase D