Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3633610
End position: 3633645
Length: 36

DNA sequence
>NC_015726, from 3633610 to 3633645 (36 bp); Cupriavidus necator N-1 CTGCTGCGACTGCTGCGACTGCTGCGACTGCTGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3633149-3634477	Sequence	CNE_1c34930 - hypothetical protein (Protein is coded in complementary strand; from 3634477 to 3633149)