Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2091249
End position: 2091284
Length: 36

DNA sequence
>NC_015726, from 2091249 to 2091284 (36 bp); Cupriavidus necator N-1 CCGGGTCGCTTCCCGGGTCATTTCGCGGGTCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2090927-2091565	Sequence	CNE_1c20210 - 1-acyl-sn-glycerol-3-phosphate acyltransferase (Protein is coded in complementary strand; from 2091565 to 2090927)