Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2067675
End position: 2067710
Length: 36

DNA sequence
>NC_015726, from 2067675 to 2067710 (36 bp); Cupriavidus necator N-1 GCGGAGCCGGAGCCGGAGCCGGAGCCGGAGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2066816-2068153	Sequence	CNE_1c19990 - hypothetical protein (Protein is coded in complementary strand; from 2068153 to 2066816)