Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1972342
End position: 1972377
Length: 36

DNA sequence
>NC_015726, from 1972342 to 1972377 (36 bp); Cupriavidus necator N-1 CCATGAAAGCCACCATGCGAGCCACCATGCGAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1972324-1972809	Sequence	CNE_1c19070 - hypothetical protein (Protein is coded in complementary strand; from 1972809 to 1972324)