Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 49276
End position: 49305
Length: 30

DNA sequence
>NC_015726, from 49276 to 49305 (30 bp); Cupriavidus necator N-1 ACGCACCGGCGCGCAGCGGCACGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 48954-49748	Sequence	CNE_1c00450 - IclR family transcriptional regulator (Protein is coded in complementary strand; from 49748 to 48954)