Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1500355
End position: 1500384
Length: 30

DNA sequence
>NC_015726, from 1500355 to 1500384 (30 bp); Cupriavidus necator N-1 CAGCCGCGCGCTGCTGCGCGAGGCCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1500126-1500635	Sequence	CNE_1c14830 ispF 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase