Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1476590
End position: 1476619
Length: 30

DNA sequence
>NC_015726, from 1476590 to 1476619 (30 bp); Cupriavidus necator N-1 CGATGACGAAGACGGTGACGATGACGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1475371-1476633	Sequence	CNE_1c14620 rluD ribosomal large subunit pseudouridine synthase D
ORF... 1476617-1477420	Sequence	CNE_1c14630 - hypothetical protein