Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1000398
End position: 1000427
Length: 30

DNA sequence
>NC_015726, from 1000398 to 1000427 (30 bp); Cupriavidus necator N-1 GGCGGCAGCAGGCCCCAGCAGGCGGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 999714-1000496	Sequence	CNE_1c09750 - hypothetical protein (Protein is coded in complementary strand; from 1000496 to 999714)