Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3807246
End position: 3807272
Length: 27

DNA sequence
>NC_015726, from 3807246 to 3807272 (27 bp); Cupriavidus necator N-1 GGCGGCGGTGGCGGCGGTGGCGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3807057-3807959	Sequence	CNE_1c36470 - hypothetical protein (Protein is coded in complementary strand; from 3807959 to 3807057)