Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3633624
End position: 3633650
Length: 27

DNA sequence
>NC_015726, from 3633624 to 3633650 (27 bp); Cupriavidus necator N-1 GCGACTGCTGCGACTGCTGCGACTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3633149-3634477	Sequence	CNE_1c34930 - hypothetical protein (Protein is coded in complementary strand; from 3634477 to 3633149)