Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3343864
End position: 3343890
Length: 27

DNA sequence
>NC_015726, from 3343864 to 3343890 (27 bp); Cupriavidus necator N-1 GCCGCCTTCGCTGCCTTCGCCGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3343774-3344688	Sequence	CNE_1c32080 ftsQ cell division protein FtsQ (Protein is coded in complementary strand; from 3344688 to 3343774)