Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3012374
End position: 3012400
Length: 27

DNA sequence
>NC_015726, from 3012374 to 3012400 (27 bp); Cupriavidus necator N-1 GCCGCACCGGCCGCACCGGCCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3012297-3013901	Sequence	CNE_1c28990 gsiB4 glutathione ABC transporter substrate binding protein GsiB