Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2291442
End position: 2291468
Length: 27

DNA sequence
>NC_015726, from 2291442 to 2291468 (27 bp); Cupriavidus necator N-1 TGCCCTGGCCGCCCTGGCTGCTCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2289890-2291788	Sequence	CNE_1c22180 rluB ribosomal large subunit pseudouridine synthase B (Protein is coded in complementary strand; from 2291788 to 2289890)