Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1786649
End position: 1786675
Length: 27

DNA sequence
>NC_015726, from 1786649 to 1786675 (27 bp); Cupriavidus necator N-1 GGCGCAGCTCGCGCAGCTGGCGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1786378-1787544	Sequence	CNE_1c17330 soxB sarcosine oxidase subunit beta (Protein is coded in complementary strand; from 1787544 to 1786378)