Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2087100
End position: 2087124
Length: 25

DNA sequence
>NC_015726, from 2087100 to 2087124 (25 bp); Cupriavidus necator N-1 CGGCGCAGCGCAGCGCAGCGAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2086792-2087805	Sequence	CNE_1c20170 qor3 quinone oxidoreductase Qor (Protein is coded in complementary strand; from 2087805 to 2086792)