Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1865921
End position: 1865945
Length: 25

DNA sequence
>NC_015726, from 1865921 to 1865945 (25 bp); Cupriavidus necator N-1 GGGGCGTGGCGGGGGCGGGCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1864708-1866021	Sequence	CNE_1c18060 ordL2 oxidoreductase OrdL (Protein is coded in complementary strand; from 1866021 to 1864708)