Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1609731
End position: 1609755
Length: 25

DNA sequence
>NC_015726, from 1609731 to 1609755 (25 bp); Cupriavidus necator N-1 CGCTGCGCAGCGCGGCGATGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1609034-1610335	Sequence	CNE_1c15820 - hypothetical protein (Protein is coded in complementary strand; from 1610335 to 1609034)