Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 95443
End position: 95466
Length: 24

DNA sequence
>NC_015726, from 95443 to 95466 (24 bp); Cupriavidus necator N-1 TCGGCCACGGCCTCGGCCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 94420-95847	Sequence	CNE_1c00940 mnmE tRNA modification GTPase MnmE (Protein is coded in complementary strand; from 95847 to 94420)