Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 788566
End position: 788589
Length: 24

DNA sequence
>NC_015726, from 788566 to 788589 (24 bp); Cupriavidus necator N-1 CCACCGCCAGCGCGACCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 787971-789614	Sequence	CNE_1c07710 - FeT family ABC transporter permease (Protein is coded in complementary strand; from 789614 to 787971)