Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 709377
End position: 709400
Length: 24

DNA sequence
>NC_015726, from 709377 to 709400 (24 bp); Cupriavidus necator N-1 CAGGGCCAGCGCCAGCGCCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 709315-710403	Sequence	CNE_1c06940 - acyltransferase (Protein is coded in complementary strand; from 710403 to 709315)