Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 612886
End position: 612909
Length: 24

DNA sequence
>NC_015726, from 612886 to 612909 (24 bp); Cupriavidus necator N-1 CGGCGCCGGTGCCGGCGCCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 612408-613592	Sequence	CNE_1c06040 - HAAT family ABC transporter permease (Protein is coded in complementary strand; from 613592 to 612408)