Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 551492
End position: 551515
Length: 24

DNA sequence
>NC_015726, from 551492 to 551515 (24 bp); Cupriavidus necator N-1 GGCGGCGTCGGCAGCGGCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 549933-551543	Sequence	CNE_1c05460 lnt apolipoprotein N-acyltransferase Lnt (Protein is coded in complementary strand; from 551543 to 549933)