Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 550844
End position: 550867
Length: 24

DNA sequence
>NC_015726, from 550844 to 550867 (24 bp); Cupriavidus necator N-1 CAGGGCCAGTGCCAGTGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 549933-551543	Sequence	CNE_1c05460 lnt apolipoprotein N-acyltransferase Lnt (Protein is coded in complementary strand; from 551543 to 549933)