Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 442442
End position: 442465
Length: 24

DNA sequence
>NC_015726, from 442442 to 442465 (24 bp); Cupriavidus necator N-1 CTGCGCCTGGGCCTGTGCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 441837-442817	Sequence	CNE_1c04430 - multidrug resistance efflux pump (Protein is coded in complementary strand; from 442817 to 441837)