Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3753973
End position: 3753996
Length: 24

DNA sequence
>NC_015726, from 3753973 to 3753996 (24 bp); Cupriavidus necator N-1 ACCAGCACCAGGGCCAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3753010-3754062	Sequence	CNE_1c36050 - ABC transporter permease (Protein is coded in complementary strand; from 3754062 to 3753010)