Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3719657
End position: 3719680
Length: 24

DNA sequence
>NC_015726, from 3719657 to 3719680 (24 bp); Cupriavidus necator N-1 GCGCCAGCGCCAGCCCCAGGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3719464-3720690	Sequence	CNE_1c35790 kefB2 Kef-type K+ transport system membrane component KefB (Protein is coded in complementary strand; from 3720690 to 3719464)