Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3388446
End position: 3388469
Length: 24

DNA sequence
>NC_015726, from 3388446 to 3388469 (24 bp); Cupriavidus necator N-1 GCCAGCGCCAGCGCAAGCCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3387909-3388562	Sequence	CNE_1c32460 artQ arginine transport system permease ArtQ (Protein is coded in complementary strand; from 3388562 to 3387909)