Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3348892
End position: 3348915
Length: 24

DNA sequence
>NC_015726, from 3348892 to 3348915 (24 bp); Cupriavidus necator N-1 CGACCACCACCACGGCCACGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3348219-3349460	Sequence	CNE_1c32120 ftsW cell division protein FtsW (Protein is coded in complementary strand; from 3349460 to 3348219)