Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3235195
End position: 3235218
Length: 24

DNA sequence
>NC_015726, from 3235195 to 3235218 (24 bp); Cupriavidus necator N-1 GCGCCAGGGCCAGCACCAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3234873-3235262	Sequence	CNE_1c31080 - guanyl-specific ribonuclease (Protein is coded in complementary strand; from 3235262 to 3234873)