Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3082930
End position: 3082953
Length: 24

DNA sequence
>NC_015726, from 3082930 to 3082953 (24 bp); Cupriavidus necator N-1 GCCGCGGCCGCAGCGGCGTCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3082696-3083043	Sequence	CNE_1c29630 - hypothetical protein (Protein is coded in complementary strand; from 3083043 to 3082696)