Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 3029708
End position: 3029731
Length: 24

DNA sequence
>NC_015726, from 3029708 to 3029731 (24 bp); Cupriavidus necator N-1 CCCGCCTCCGCCCCCGACACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3028096-3029709	Sequence	CNE_1c29110 cobU adenosylcobinamide-phosphate guanylyltransferase (Protein is coded in complementary strand; from 3029709 to 3028096)
ORF. 3029688-3030353	Sequence	CNE_1c29120 cobQ cobyric acid synthase CobQ