Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 273901
End position: 273924
Length: 24

DNA sequence
>NC_015726, from 273901 to 273924 (24 bp); Cupriavidus necator N-1 GTCGTGGTGGTGGCCGTGGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 273449-274438	Sequence	CNE_1c02760 czcD1 Co/Zn/Cd efflux system component CzcD (Protein is coded in complementary strand; from 274438 to 273449)