Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2726811
End position: 2726834
Length: 24

DNA sequence
>NC_015726, from 2726811 to 2726834 (24 bp); Cupriavidus necator N-1 CGGGCGCGGGCCTGGGCGCGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2724897-2727713	Sequence	CNE_1c26380 polA DNA polymerase I (Protein is coded in complementary strand; from 2727713 to 2724897)