Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2691496
End position: 2691519
Length: 24

DNA sequence
>NC_015726, from 2691496 to 2691519 (24 bp); Cupriavidus necator N-1 CAGCGCCACCGCCGGCGCCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2690987-2691868	Sequence	CNE_1c26060 - permease (Protein is coded in complementary strand; from 2691868 to 2690987)