Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 2421387
End position: 2421410
Length: 24

DNA sequence
>NC_015726, from 2421387 to 2421410 (24 bp); Cupriavidus necator N-1 CGGCGCATCAGCGCATCGGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2421246-2422505	Sequence	CNE_1c23370 - diguanylate cyclase (Protein is coded in complementary strand; from 2422505 to 2421246)