Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 186415
End position: 186438
Length: 24

DNA sequence
>NC_015726, from 186415 to 186438 (24 bp); Cupriavidus necator N-1 TCATGGTCATGATCGTGGTCATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 186019-187104	Sequence	CNE_1c01850 - GTPase G3E family (Protein is coded in complementary strand; from 187104 to 186019)