Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1764476
End position: 1764499
Length: 24

DNA sequence
>NC_015726, from 1764476 to 1764499 (24 bp); Cupriavidus necator N-1 CCGGCATCGGCATCGGCATCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1764341-1765444	Sequence	CNE_1c17150 dmlA D-malate dehydrogenase (Protein is coded in complementary strand; from 1765444 to 1764341)