Sequence retrieval

Genome: Cupriavidus necator N-1
Start position: 1661557
End position: 1661580
Length: 24

DNA sequence
>NC_015726, from 1661557 to 1661580 (24 bp); Cupriavidus necator N-1 GCGGCCGCTGCCGCGACCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1660960-1661739	Sequence	CNE_1c16300 pcm1 protein-L-isoaspartate O-methyltransferase Pcm (Protein is coded in complementary strand; from 1661739 to 1660960)