Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2121617
End position: 2121664
Length: 48

DNA sequence
>NC_015702, from 2121617 to 2121664 (48 bp); Parachlamydia acanthamoebae UV7 TCATCGTCGTCATCGTCATCGTCATCGTCATCGTCATCATCATCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2121533-2122120	Sequence	PUV_19310 - hypothetical protein (Protein is coded in complementary strand; from 2122120 to 2121533)