Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2861359
End position: 2861394
Length: 36

DNA sequence
>NC_015702, from 2861359 to 2861394 (36 bp); Parachlamydia acanthamoebae UV7 TGTTGTTGTTGCTGCTGCTGTTGCTGCTGTTGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2860747-2870991	Sequence	PUV_26100 - hypothetical protein (Protein is coded in complementary strand; from 2870991 to 2860747)