Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2245042
End position: 2245071
Length: 30

DNA sequence
>NC_015702, from 2245042 to 2245071 (30 bp); Parachlamydia acanthamoebae UV7 AAAAAGACTAAAAAAGCATAAAAATGACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2244719-2245096	Sequence	PUV_20390 - hypothetical protein (Protein is coded in complementary strand; from 2245096 to 2244719)