Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2121623
End position: 2121652
Length: 30

DNA sequence
>NC_015702, from 2121623 to 2121652 (30 bp); Parachlamydia acanthamoebae UV7 TCGTCATCGTCATCGTCATCGTCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2121533-2122120	Sequence	PUV_19310 - hypothetical protein (Protein is coded in complementary strand; from 2122120 to 2121533)