Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 1684114
End position: 1684143
Length: 30

DNA sequence
>NC_015702, from 1684114 to 1684143 (30 bp); Parachlamydia acanthamoebae UV7 TTCAGTTTCGGTTTCAATTTCAGTTTCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1683521-1692673	Sequence	PUV_14960 - hypothetical protein (Protein is coded in complementary strand; from 1692673 to 1683521)