Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 644484
End position: 644510
Length: 27

DNA sequence
>NC_015702, from 644484 to 644510 (27 bp); Parachlamydia acanthamoebae UV7 GTGGCTCCAGTAGCTCCAGTGGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 643782-648854	Sequence	PUV_05930 - hypothetical protein (Protein is coded in complementary strand; from 648854 to 643782)