Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 160820
End position: 160846
Length: 27

DNA sequence
>NC_015702, from 160820 to 160846 (27 bp); Parachlamydia acanthamoebae UV7 TCATCTTCATCATCTTCCTCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 160592-161779	Sequence	PUV_01520 - hypothetical protein (Protein is coded in complementary strand; from 161779 to 160592)