Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 1486506
End position: 1486530
Length: 25

DNA sequence
>NC_015702, from 1486506 to 1486530 (25 bp); Parachlamydia acanthamoebae UV7 TTTTTTTTCTTTTTTTTCTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1486525-1487616	Sequence	PUV_13060 - hypothetical protein (Protein is coded in complementary strand; from 1487616 to 1486525)